Wednesday, November 15, 2017

The Secret to Long Life. A Zombie Gene. Comedy Men are so Awful. - olgalazin@gmail.com - Gmail

The Secret to Long Life. A Zombie Gene. Comedy Men are so Awful. - olgalazin@gmail.com - Gmail:



The kind of ultrarare mutations that supercentenarians might harbor, Dr. Church believed, were not likely to be detected with standard techniques, which scan only the places in the genome where DNA is already known to vary between individuals.
To look for as-yet-uncataloged variations would require sequencing all of the supercentenarians’ six billion genetic letters, a far more expensive procedure. When he and Mr. Clement first discussed the idea in 2010, the cost was about $50,000 per genome.
But the price was falling. And with the financial support of a handful of like-minded wealthy individuals who agreed to invest in the exploratory phase of the project, “it just seemed,” Mr. Clement said, “like something I could do.”
Even with the Harvard name as a calling card, several of the families he contacted over the next few years did not respond to his inquiries. A few, Mr. Clement knew, had already been approached by laboratories at Stanford and Boston University, which were collecting their own stashes of supercentenarian DNA.
“She already did her DNA donation,” Paul Cooper, the grandson of Besse Cooper, a 116-year-old former suffragist, told Mr. Clement, who had driven several hundred miles to her Monroe, Ga., nursing home in 2012.
Walter Breuning, of Great Falls, Mont., one of just a handful of men known to have lived to 114, replied in late 2010 that it was his preference not to risk winter meetings. He died early the next spring.
An invitation to the 111th birthday party of James Sisnett in Barbadosfinally served as Mr. Clement’s entree in February 2011. He died two years later.
Mr. Sisnett, who grew his own food until he was 105, was “still fascinated by seeing a nice-looking backside” when he was in his 110s, his daughter, Everine Carter, 88, recalled in a telephone interview.

Losing Precious Samples

The best time to get DNA from a supercentenarian, Mr. Clement found, is midmorning. By lunchtime, they would prefer to be eating. After lunch, they might be groggy or napping.
Most, like Dorothy Peel of London, then 108, had sharp minds. Ms. Peel inspected the informed consent form through her reading glasses and peppered him with questions about other supercentenarians he had met.
Photo
Dorothy Peel signed the consent form to participate in the supercentenarian study.CreditJames Clement
Crisscrossing Europe in 2011, Mr. Clement hit his collecting stride. But there were some bumps.
He had ordered an inexpensive kit that allowed him to prick a supercentenarian’s finger and deposit a drop of blood on a card to preserve it, often used by geneticists in the field.
Within a few months he had blood drops from 15 donors, including Ralph Tarrant of Sheffield, England, who at 108 completed the London Times crossword puzzle every afternoon.
Not until he had switched to hiring a phlebotomist to perform blood draws with a needle did he learn that the cards with the original 15 samples were defective. “We could not detect any DNA,” read a 2011 email from the laboratory.
Mr. Clement confessed the news to Dr. Church in a meeting at his Harvard office. “You didn’t test the cards?” the geneticist asked him gently.
Still, Mr. Clement had 23 good samples in hand, and the cost of sequencing by this time had fallen to some $15,000 per genome. With his remaining funds, he sequenced 15, leaving the rest in cold storage.
Photo
Mr. Clement holding blood samples from Clarence Matthews. CreditIvan Kashinsky for The New York Times
Mr. Clement quickly discovered 2,500 differences between the supercentenarian DNA and those of controls. But even with help from graduate students in Dr. Church’s lab, it was hard with such a small group to know which, if any, were significant.
So over the next few years, Mr. Clement, working without a salary, collected samples whenever he could, adding another dozen from supercentenarians across the United States.
In the spring of last year, a company Dr. Church had co-founded, Veritas Genetics, announced that it would sequence human genomes for $1,000 each. Dr. Church told Mr. Clement that Veritas would sequence the remaining samples, and so he set out to collect a few more.

Advice From America’s Oldest Man

Photo
Asked how one could hope to live a long, healthy and happy life, Mr. Matthews offered some advice: “Keep breathing.” CreditIvan Kashinsky for The New York Times
In July 2016, I was invited to accompany Mr. Clement to Mr. Matthews’s home in California. As much as I looked forward to meeting my first supercentenarian, I was not prepared to envy his win in the genetic longevity lottery.
I had feared he would be lonely, a concern echoed by several of the Facebook viewers who watched me ply him with questions over a live video stream the morning we met. “I don’t want to outlive my friends and family,” one typed. “That’s no fun.”
The prospect of shifting today’s average life span to that of the known limit of all humanity is disorienting. An average life expectancy of 80 in some ways seems generous — it was just 48 when Mr. Matthews was born in 1906. Most of us expect around 80 years on the planet, assuming nothing horrendous happens.
“When you have children the first time, it don’t come with a manual, and it don’t come with a manual when your dad gets to be 100, then 105, then 110,” said Mr. Matthews’s son, Steve, 75, who also gave blood the day we visited.
But Mr. Matthews asserted without hesitation that he still enjoyed life. Pleasures included his lunchtime smoothie, his family, the kindness of his caregiver, and — this with a nod to a New York Times photographer and a rakish grin — “having my picture taken.”
He reminisced fondly about his second wife, Katherine, who died in 1980 and with whom he had loved to dance.
At 110, he said he had never been diagnosed with a serious illness. The younger Mr. Matthews recalled that his father had played a one-under-par, 18-hole golf game on his 99th birthday. Having built a successful real estate business, he provided financial support to his last surviving sibling, a sister who was 105.
Talking to him, it was hard not to fantasize about the possibility that, as another Facebook participant suggested, “by the time we get to that age, we may all be living to 110.”
At the time the oldest man in America, Mr. Matthews sometimes strained to hear, but his sense of humor and perspective were intact. If that was what we wanted, he advised, “Keep breathing.”
Mr. Matthews died this summer. His DNA was sequenced a few weeks later, and last month Mr. Clement uploaded it to the database. Like all normal human genome sequences, the beginning of his first chromosome reads like this:
TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT
Whether, in combination with the genomes of his fellow supercentenarians, the rest contains the secret to a long, healthy and happy life remains to be seen.




Correction: November 15, 2017 
An earlier version of this article misstated the Massachusetts town in which Goldie Michelson resided. She lived in Worcester, not Gloucester.


'via Blog this'
Post a Comment